You have discovered a new gene “X” that appears to be regulated by 3 transcripti
ID: 142548 • Letter: Y
Question
You have discovered a new gene “X” that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene “Y” appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.
The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA
The known DNA consensus sequence for each Transcription Factor is:
E2F – GCCAATGTGCTGA
SP-1 – GCTGACAGTTAA
C/EBPa – ACAGTTAATTAGG
It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.
Explanation / Answer
Transcription of eukaryotic gene requires many protein factor called transcription factors to initiate as well as to regulate transcription .The consensus sequence present in core promoter (the TATA box initiator sequence)primarily determine the location of start point whereas the sequence element influence the freequency of initiation . These elements in any promoter differ in number , location and orientation . In the above experiment there are three trancription factor E2F , Sp1 , C/EBPa . At first E2F which act as a transcription factor and induces many gene to transcribe . High levels of E2F activates the transcription of cyclin A gene . E2Fs as TFs bind to the TTTCCCGC consensus binding site in the target promoter sequence. E2F activity is controlled by pRb protein , when pRB binds to E2F its become suppressed . Phosphorylation of pRB ( initiated by D-CDK4, D-CDK6, E-CDK2) reduces its affinity to the for E2F and allows E2F to heterodimerize with factor DP(DNA binding protein) . Thus when pRB is phosphorylated leads to the activation of E2F proteins and expression pfthe E2F responsive genes. Activator E2F proteins can then transcribe S phase promoting genes. The protein encoded by Sp1 gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters and regulates the expression of a large number of genes involved in a variety of cellular processes. C/EBPa , is a intronless gene codes a transcription factor that contains a leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of many genes.