Please answer this multiple-part question regarding probe synthesis and nucleic
ID: 142520 • Letter: P
Question
Please answer this multiple-part question regarding probe synthesis and nucleic acid hybridization:
a) DNA (or RNA) molecules are generally radiolabeled by using an isotope that is a component of the ____________and the common isotopes used are ________.
A. bases/14-C and 15-N
B. phosphates/ 32-P and 17-N
C. pentose sugar/ 14-C and 15-O
D. bases or phosphates/32-P and 3-H
b) You want to test if new DNA has been synthesized in cells treated with a drug, you would grow the cell in the presence of 32P-labeled ________.
A. ATP
B. dGTP
C. CTP
D. dTTP
E. UTP
c) Your probe is labeled with biotin; you should trace the probe using ________.
A. X-ray films
B. streptavidin
C. a fluorescent microscope
D. a beta or optical scanner
E. enzyme-linked antibodies
d) You cut a piece of DNA with EcoRI and want to end-label the DNA with 32P. You would use nucleotides labeled at the _______ and the enzyme __________ to complete the job.
A. beta phosphate/ polynucleotide kinase (PNK)
B. alpha phosphate/DNA polymerase
C. gamma phosphate/ DNA ligase
D. any of these/ any of these
e) The molecule 5’CCCCAUUGAUGGCGAAUUGC3’ is attached to a membrane. The membrane is a _____________. A. Southern blot
B. Northern blot
C. Western blot
D. Northern or southwestern blot
Explanation / Answer
A. OPTION D is the correct answer
B. OPTION C is the correct answer
C OPTION B is the correct answer
It is an affinity based DNA-binding proteins detection system.
D OPTION B is the correct answer
E OPTION A is the correct answer
Southren blotting is a procedure for identifying specific sequences of DNA.