For the next part of the assignment, you need to take the appropriate sequence b
ID: 150004 • Letter: F
Question
For the next part of the assignment, you need to take the appropriate sequence below (based on the first letter of your last name), and use the nucleotide BLAST function on GenBank () to identify A) What gene was amplified B) From what organism the sequence came (scientific and common name), and C) in which Order that species is taxonomically placed
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
CTGTGACTTTGCCAAGTGGAGGTGTGTGCTGAAGATCTCAGACAGCTGCCCCACACCTCTTGCCATCGCAGAGAATGCCAACGTACTGGCCAGATATGCCAGCATTTGTCAACAGGTTGGCATCACCCACTCAATAGAAATGACACCCAATTTGCAAGTACTACAATGGCACTCAGTGAAATTTGAACAATGCTAATATGAATCAGCAGC
Explanation / Answer
The gene amplified has following details
A)Phycodurus eques isolate eques1D aldolase-like protein gene, partial cds (coding sequence)
GenBank accession number KM201579.1
B) Phycodurus eques (leafy seadragon) - Source
C) Eukaryota; Metazoa; Chordata; craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei; Syngnathidae; Phycodurus