Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

In-Fusion Cloning Human caveolin-2 (Cav2) and caveolin-3 (Cav3) are homologous m

ID: 163180 • Letter: I

Question

In-Fusion Cloning

Human caveolin-2 (Cav2) and caveolin-3 (Cav3) are homologous membrane proteins which are involved in development of certain types of cancers if their cellular expression is misregulated. A caveolin consists of two domains – the N-terminal and the C-terminal - each serving a different functional role. To develop a viable target for pharmaceutical intervention the interactions of Cav2 and Cav3 with neighboring proteins and each other need to be understood. The research project requires construction and expression of a 150 amino acid chimera protein that has the N-terminal domain of Cav2 and the C-terminal domain of Cav3. For this, you will need to clone 42 C-terminal residues of Cav3 after the 108 N-terminal residues of Cav2. Two plasmids are available, one is an expression vector encoding Cav2, and another is a cloning vector encoding Cav3.

Cav-2 DNA sequence

atggggctgg agacggagaa ggcggacgta cagctcttca

       tggacgacga ctcctacagc caccacagcg gcctcgagta cgccgacccc gagaagttcg

      cggactcgga ccaggaccgg gatccccacc ggctcaactc gcatctcaag ctgggcttcg

      aggatgtgat cgcagagccg gtgactacgc actcctttga caaagtgtgg atctgcagcc

      atgccctctt tgaaatcagc aaatacgtaa tgtacaagtt cctgacggtg ttcctggcca

       ttcccctggc cttcattgcg ggaattctct ttgccaccct cagctgtctg cacatctgga

      ttttaatgcc ttttgtaaag acctgcctaa tggttctgcc ttcagtgcag acaatatgga

      agagtgtgac agatgttatc attgctccat tgtgtacgag cgtaggacga tgcttctctt

       ctgtcagcct gcaactgagc caggattga

Cav-3 DNA sequence

       atg atggcagaag agcacacaga tctcgaggcc cagatcgtca

      aggatatcca ctgcaaggag attgacctgg tgaaccgaga ccccaagaac attaacgagg

      acatagtcaa ggtggatttt gaagacgtga tcgcagagcc tgtgggcacc tacagctttg

       acggcgtgtg gaaggtgagc tacaccacct tcactgtctc caagtactgg tgctaccgtc

      tgttgtccac gctgctgggc gtcccactgg ccctgctctg gggcttcctg ttcgcctgca

      tctccttctg ccacatctgg gcggtggtgc catgcattaa gagctacctg atcgagatcc

      agtgcatcag ccacatctac tcactctgca tccgcacctt ctgcaaccca ctcttcgcgg

      ccctgggcca ggtctgcagc agcatcaagg tggtgctgcg gaaggaggtc taa

Show the final nucleotide sequence of the chimeric construct after cloning. Label the coding region for the chimeric protein.

Explanation / Answer

Final nucleotide sequence is

ATGGGGCTGGAGACGGAGAAGGCGGACGTACAGCTCTTCATGGACGACGACTCCTACAGCCACCACAGCGGCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCGGACCAGGACCGGGATCCCCACCGGCTCAACTCGCATCTCAAGCTGGGCTTCGAGGATGTGATCGCAGAGCCGGTGACTACGCACTCCTTTGACAAAGTGTGGATCTGCAGCCATGCCCTCTTTGAAATCAGCAAATACGTAATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCCACCCTCAGCATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCAAGGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGGATTTTGAATAG

protein will be coded by whole sequence since it doesn't have any introns or promoter region.

Don't forget to give feedback.