How many of each of the following does this double-stranded DNA sequence have? A
ID: 164548 • Letter: H
Question
How many of each of the following does this double-stranded DNA sequence have?
ATCTAGCTCCACACCTTGTTCCATC
TAGATCGAGGTGTGGAACAAGGTAG
A.__________ 3 hydroxyl (OH) groups (2 pts)
B. __________ hydrogen bonds (2 pts)
C. __________ pyrimidines (2 pts)
D. __________ phosphodiester bonds (2 pts)
E. __________ What is the A/T ratio for this double-stranded sequence? (2 pts)
2. Consider the following genetic evidence from your forensic genetics lab. Locus D3S1358 vWA FGA D18S51
Genotype (15,17) (19,19) (22,23) (12,12)
a.
What must be true about these four loci for them to be used to calculate a Pm (3 pts)?
b. Using the table of STR allele frequencies at the back of the exam, calculate the Pm for the above genotype using the allele frequencies for Caucasians. Show your work. (6pts)
Explanation / Answer
1.
A. two 3'-OH groups (one i each strand)
B. 62 hydrogen bonds
there are 13 AT base pairs which have 2 hydrogen bonds between them. (13 x 2 = 26)
there are 12 GC base pairs which have 3 hydrogen bonds between them.(12 x 3 = 36)
total (26 + 36) = 62
3. 25 pyrimidines.
thymine and cytosine are pyrimidines. 13 AT base pairs indicate 13 thymine bases. similarly 12 cytosine bases. total 25.
4. 48 phoshodiester bonds.
phosphodiester bonds are those which join adjacent nucleotides. since there are 25 bases in each strand, 24 phosphodiester bonds exist in each strand. therefore, 2 strands consist of 48.
5. since there are 13 AT base pairs out of 50 base pairs, AT percentage would be 52 % (A/T= 26/50 or 13/25)