NAME: Topic: Central Dogma 5. The sequence of a complete eukaryotic gene encodin
ID: 200828 • Letter: N
Question
NAME: Topic: Central Dogma 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All.ef the written sequences on the template strand are transcribed into RNA 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? c. What is the sequence of the nucleotides in the processed (mature) mRNA molecule for this gene? Indicate the 5' and 3' polarity of this mRNAExplanation / Answer
Ans) in eukaryotes the DNA is located in the nucleus and it has the information about the amino acid sequence of a protein. All the proteins which expressed in a cell are coded by the genes which are present in DNA. The RNA polymerase bind to the promoter sequences of DNA and copy the genetic information present in DNA into mRNA by transcription processes and then ribosome’s translate this information located in mRNA (in the form of codons) as a protein by a process called translation. The template DNA strand or negative strand or nonsense strand of DNA is complementary to mRNA. The RNA polymerase binds to the promoter region which is located at an upstream portion of a gene and initiates the synthesis of mRNA by denovo fashion. From the transcription bubble (DNA-RNA hybrid), 5 end of mRNA is released into nucleoplasm during transcription processes. The mRNA which released into the nucleoplasm has the introns so-called heterogenous mRNA. Now the heterogenous mRNA undergoes post-transcriptional processing. The first event in mRNA processing is 5’-capping. In 5’-capping the 5’ end of mRNA is added with guanine residues. In eukaryotes, 7-methyl guanosine is 5’-cap which increases the half-life of mRNA. At the 3’ end adenine residues are added by the process called polyadenylation. The Introns in the mRNA replaced by the process called splicing. After completion of three events, the heterogeneous mRNA is called mature mRNA which is transported to the cytoplasm where it is translated into protein.
5’-CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC-3’ (non-template DNA strand)
3’-GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG-5’ (template DNA strand)
1) Which strand is template strand?
3’-GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG-5’
2) Which direction (right to left or left to right) does RNA polymerase move along the template as it transcribes this gene?
RNA polymerase synthesize the mRNA in 5’ to 3’ direction so It will move in left to right
3) What is the sequence of the nucleotides in the processed (mature) mRNA molecule for this gene? Indicate the 5’ and 3’ polarity of this mRNA.
The given DNA sequence does not code for the protein which given in the question. It codes a different protein.
5’-GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG-3’ (template DNA strand)
5’-GGGGAUACGGGGGGACCCCCUCCUAGUUUUGUGAAUGGACAUGUACCG-3’ (mRNA to be transcribed) and polarity is 5’- 3’
N terminus-GDTGGPPPSFVNGHVP-C terminus (protein to be translated)