NAME: Topic: Central Dogma 5. The sequence of a complete eukaryotic gene encodin
ID: 201278 • Letter: N
Question
NAME: Topic: Central Dogma 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All.at the written sequences on the template strand are transcribed into RNA 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5 a. Which strand is the template strand? Top-strand (I believe) b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? Right to left c. What is the sequence of the nucleotides in the processed (mature) mRNA molecule for this gene? Indicate the 5' and 3' polarity of this mRNA.Explanation / Answer
1. RNA polymerase synthesizes an RNA transcript complementary to the DNA template strand in the 5' to 3' direction.
so, 3 to 5 is template strand.
2.On template strand it will move in 3’ to 5’ direction (Left to Right).
3.