Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

I have excerpted a short section of the actual DNA sequence from the gene fliA i

ID: 202489 • Letter: I

Question

I have excerpted a short section of the actual DNA sequence from the gene fliA in E. coli. So that you can copy and paste it, it is also on slide 5 of the powerpoint slide set you used for questions 1 and 2. This gene encodes an alternate sigma factor, called sigma28. For this gene, the (+) strand is the bottom strand.

GGTGATTAGCAGGCTAATTTTTGGGACGTCTTTGCCTATTAGTACGGCTATTGAGTATATTGCCTCCCGACAAATAGTACTTAAGTGAGATATGGCCACTAATCGTCCGATTAAAAACCCTGCAGAAACGGATAATCATGCCGATAACTCATATAACGGAGGGCTGTTTATCATGAATTCACTCTATACC

A. Two possible promoters are shown, one in bold, and the other in bold and itaicised. Considering both how the gene will be transcribed and how the resulting mRNA will be translated, decide which promoter (the bold one or the bold and italicised one) will be used to transcribe the fliA gene. Explain your choice. (Hint: start by writing the sequence of the mRNA that would be made from each promoter, and then try to translate the mRNA.)

B.   Make sketches showing a ribosome translating this gene. Begin with the ribosome as it would appear after adding the 3rd amino acid of the protein, and then show the steps involved in adding the 4th amino acid to the protein. Label all 5’ and 3’ ends, the A, P and E sites, and the tRNA anticodon. Use the codon sequence to identify each of the four amino acids.

C.  Below are two of the many operons that produce flagella in   E. coli. What do the little arrows labeled “sigma28” signify? Why is there an arrow in front of fliF and fliL, but not in front of the other genes? Why would the cell use sigma28 to transcribe these genes, but use sigma70 to transcribe fliA, as seen in part (A) above?

MIE iliF TIG 1H INfio 1io 2012000 2,01 2013,000 2014,000 2015,000 2017,000 2,020,000 2,011,000 2016,000 201 2019000

Explanation / Answer

Gene segment (promoter)     TTAGCA

mRNA                                    AATCGT

codons                                    AAU CGU or A AUC GT or AA UCG U

Gene segment (promoter)    TTGCCTATTAG

mRNA                                  AACGGAUAAUC

                            

Gene segment (promoter)        TATATT

mRNA                                       AUAUAA