Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

This gene encodes an alternate sigma factor, called - 28 . For this gene, the (+

ID: 203717 • Letter: T

Question

This gene encodes an alternate sigma factor, called -28 . For this gene, the (+) strand is the bottom strand.

A. Two possible promoters are shown, one in blue and one in green. Considering how the gene will be transcribed and how the resulting mRNA will be translated, decide which promoter (the green one or the blue one) will be used to transcribe the fliA gene. Explain your choice. (Hint: start by writing the sequence of the mRNA that would be made from each promoter, and then try to translate the mRNA.)

B. Make sketches showing a ribosome translating this gene. Begin with the ribosome as it would appear after adding the 3rd amino acid of the protein, and then show the steps involved in adding the 4th amino acid to the protein. Label all 5’ and 3’ ends, the A, P and E sites, and the tRNA anticodon. Use the codon sequence to identify each of the four amino acids.

GGTGATTAGCAGGCTAATIIITGGGACGTCTTTGCCTATTAGTACGGCTATTGAGTATATTGCCTCCCGACAAATAGTACTTAAGTGAGATATGG CCACTAATCGTCCGATTAAAAACCCTGCAGAAACGGATAATCATGCCGATAACTCATATAACGGAGGGCTGTTTATCATGAATTCACTCTATACC

Explanation / Answer

The promoter for fliA gene GCCGATAA is present in the second line of the sequence.
So, the mRNA generated would be: GAGUAUAUUGCCUCCCGACAAAUAGUACUUAAGUGAGAUAUGG