Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

This gene encodes an alternate sigma factor, called -28 . For this gene, the (+)

ID: 203945 • Letter: T

Question

This gene encodes an alternate sigma factor, called -28 . For this gene, the (+) strand is the bottom strand.

A. Two possible promoters are shown, one in blue and one in green. Considering both how the gene will be transcribed and how the resulting mRNA will be translated, decide which promoter (the green one or the blue one) will be used to transcribe the fliA gene. Explain your choice. (Hint: start by writing the sequence of the mRNA that would be made from each promoter, and then try to translate the mRNA.)

B. Make sketches showing a ribosome translating this gene. Begin with the ribosome as it would appear after adding the 3rd amino acid of the protein, and then show the steps involved in adding the 4th amino acid to the protein. Label all 5’ and 3’ ends, the A, P and E sites, and the tRNA anticodon. Use the codon sequence to identify each of the four amino acids.

GGTGATTAGCAGGCTAATTTTTGGGACGTCTTTGCCTATTAGTACGGCTATTGAGTATATTGCCTCCCGACAAATAGTACTTAAGTGAGATATGG CCACTAATCGTCCGATTAAAAACCCTGCAGAAACGGATAATCATGCCGATAACTCATATAACGGAGGGCTGTTTATCATGAATTCACTCTATACC

Explanation / Answer

A) mRNA:

The Green promoter must be used to transcribe the fliA gene because of the length of the gene is 20 bases and the first green promoter exactly transcribed the 20 bases of mRNA.

The whole mRNA sequence is GGCUAAUUUUUGGGACGUCUUUGCCUAUUAGUACGGCUAUUGAGUAUAUUGCCUCCCGACAAAUAGUACUUAAGUGAGAUATGG

As there is no START CODON (AUG) present in the mRNA, thus no Translation would occur in this gene.