Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Met-Tyr-Arg-Ile-Pro then it stops, I don\'t understand the last questions Questi

ID: 218024 • Letter: M

Question

Met-Tyr-Arg-Ile-Pro then it stops, I don't understand the last questions

Question 9 6 pts Below is a DNA fragment comprising the sequence of a gene coding for the human protein CV H ATTGCACGAATTCGTAGGTAGGGGATCCGTACGGTAGTTGAAGCTTAAGTCCACCATGTAT TCAAGCTTTGTCTGCA ATTCCTTGATGGTTGTAAGTCCGGATCCTGCGTGGCATT Write in the case the corresponding amino acid sequence of the protein (write in this manner Leu-Gly-Leu) You would like to clone this gene in a plasmid next to a constitutive promoter (A constitutive promoter results in the constant transcription of a gene) and then insert this plasmid into bacteria in order to produce a high level of protein CV H. You have the choice between 3 plasmids: pA, pB and pC. Promoter Multiple Cloning Sites Sites are listed in order Hindlll BamH EcoRI Pst pA Promoter Multiple Cloning Sites Sites are listed in order Pst BamH Hindlll ECORI ?? Promoter Multiple Cloning Sites Sites are listed in order .EcoR pC Pst HindlI .BamH You also have the following enzymes: EcORI GIAATTC BamHI GIGATCC Hindil AAGCTT CTGCA|G Pstl Which plasmid would you use to clone your gene? Which enzyme(s) would you use to cut the plasmid and the DNA fragment to facilitate the insertion of the fragment into the plasmid? You will be asked to explain your answer in the next question.

Explanation / Answer

The restriction site for EcoR1 (GAATTC) is present at 8th nucleotide position(from left) of the DNA sequence.

And the restriction site BAMH1 is (GGATCC) is present from 17th nucleotide(from right) of the DNA sequence.

And by the way most of the time we use cDNA (obtained from reverse transcription of mRNA sequence) for cloning purpose. So if we have to find the amino acid sequence then we have transcribe the DNA into mRNA sequence and then translate it into amino acid sequence.

If you have any query, you cant put it on comment section. If you like my answer please do rate it.