3\' TACCGTGCGTGACATTAAGCC 5\' What would be the sequence of a DNA strand made us
ID: 227125 • Letter: 3
Question
3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of a DNA strand made using the DNA sequence shown as a template? Be sure label the 5' and 3' ends of the new strand. a) What three possible models were suggested to originally describe the nature of DNA replication? b) The Meselson and Stahl experiment provided conclusive evidence for the replication of DNA in E.coli. What pattern of bands would occur in a CsCl gradient for the above models of replication after 1 generation and after 2, if they were true? Draw in each of the "test tubes" below.Explanation / Answer
6: The sequence of new DNA strand is complimentary to that of the template strand. Adenine pairs with thymine and cytosine with guanine. The given template strand is
3' TACCGTGCGTGACATTAAGCC 5'
So, the sequence of newly synthesized strand would be
5' ATGGCACGCACTGTAATTCGG 3'