Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

3\' caattgataggtcagtcaata c at 5 5\' gttaactatccagtcagttatgta 3 Second letter UA

ID: 270080 • Letter: 3

Question

3' caattgataggtcagtcaata c at 5 5' gttaactatccagtcagttatgta 3 Second letter UAU UAC UAA Stop UGA Stop A UAG Stop UGG Trp G UGU UGC Cys Phe UCU Tyr UCC UCA Ser UUA Leu UCG UUG CUU CUC Leu CCA CCU CCA Pro CAC His CGU CCC Pro CAA1GIn CGG CUG CCG AUU AUC lle ACC AUA AUG Met ACG GUU GUC?Val GCA ACU AAU AGU Asn AGC erc AAG Lys AGGArgG ACA Thr AGA GCU GCA Ala GAC Asp GGU GCC Ala GAA1Glu GGG G GUA GUG GCG Which below represents translation of the above mRNA from question 6? N-Met Tyr Trp Leu Thr lle Glu Leu-C N-Tyr lle Thr Val Trp lle Val Asn-C N-Val Asn Tyr Pro Val Ser Tyr Val-C N-GIn Leu Tyr Gly GIn Ser lle His-C

Explanation / Answer

Answer:

Based on the given sequence, the non-template DNA sequence is from 5' to 3' direction.