Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The DNA sequence below represents an open reading frame (ORF) of an MHC transcri

ID: 262486 • Letter: T

Question

The DNA sequence below represents an open reading frame (ORF) of an MHC transcriptional unit. Transcribe and then translate this gene. 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?! The DNA sequence below represents an open reading frame (ORF) of an MHC transcriptional unit. Transcribe and then translate this gene. 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?! 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?!

Explanation / Answer

Answer:

Coding strand---5’ ATGAAAGCTCGTTGTATCTGA 3’

Template strand---3’ TACTTTCGAGCAACATAGACT 5’

Template strand synthesizes mRNA.

mRNA - 5’ AUG - AAA - GCU - CGU - UGU - AUC - UGA 3’

Protein - Met - Lys - Ala - Arg - Cyc - Ile - STOP