The DNA sequence below represents an open reading frame (ORF) of an MHC transcri
ID: 262486 • Letter: T
Question
The DNA sequence below represents an open reading frame (ORF) of an MHC transcriptional unit. Transcribe and then translate this gene. 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’Transcribed mRNA sequence?! Translated protein sequence?! The DNA sequence below represents an open reading frame (ORF) of an MHC transcriptional unit. Transcribe and then translate this gene. 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?! 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?!
Explanation / Answer
Answer:
Coding strand---5’ ATGAAAGCTCGTTGTATCTGA 3’
Template strand---3’ TACTTTCGAGCAACATAGACT 5’
Template strand synthesizes mRNA.
mRNA - 5’ AUG - AAA - GCU - CGU - UGU - AUC - UGA 3’
Protein - Met - Lys - Ala - Arg - Cyc - Ile - STOP