Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decrea

ID: 269558 • Letter: C

Question

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Q. Identify and explain thoroughly any causes that you believe may be associated with these cellular problems in one cell.

Explanation / Answer

1. Decreased pH in cytosol causes acidosis leading to lethargy and mental confusion.

2. Decrease in pH causes mitochondria to pump H+ leading to ATP production.

3. Increase in ATP raises stress.

4. Increase in hydrolysis increased ATP production.

5. Decreasing levels of glycogen and triglycerides decreases storage granules and raises stress level.

6. Cellular wastage materials rise inside the cell.

7. Increased activity of mitogen activated protein kinases occurs at the time of infection to counteract stress produced by cell.

10. Poor ion transport causes alteration in transportation of cellular nutrients, physiology etc. thereby causing cellular dysfunction.