Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decrea

ID: 269569 • Letter: C

Question

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

- Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

- Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Q. Explain how you might be able to fix the one cell with these problems using enzyme replacement therapy.

Explanation / Answer

Hydrolytic enzymes are present in the lysosomes of the cell. These enzymes bring about digestion and elimination of any particle/molecule enetering the cell under low conditions of pH. Thus, the lysosomal hydrolytic enzymes require a net acidic pH for function.

According to the information, the net pH of the cytosol decreased as well as in mitochondrial matrix. This caused increased ATP synthesis due to enhanced electrochemical gradient. Further, the cellular glycogen and triglycerides were decreased alogn with poor ion transport. The cell is also shown to have in inherited autosomal recessive mutation for hydrolytic enzymes.

Together, these set of data indicate that the cell is experiencing either lack of hydrolytic enzymes in the lysosomes or the lysosomes have been opened up to release the acidic granules as well as the hydrolytic enzymes in the cytosol, leading to net drop in pH. This could happen when either the gene encoding for hydrolytic enzyme is non-functional or the enzymes required for synthesis of phospholipids are missing (as the lysosomal membrane is unstable).

Thus, enzyme replacement therapy using supplementation of the cell with enzymes required for phospholipid bio-synthesis should solve the problem.