Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

3. A cladogram based on physical morphologies was created to show the evolutiona

ID: 276762 • Letter: 3

Question

3. A cladogram based on physical morphologies was created to show the evolutionary relationships between several species. Later, DNA sequences were obtained for the same gene in these organisms. Those sequences are shown below. Evaluate the sequencing data to determine whether it supports the existing cladogram. If there are any inaccuracies, explain how they can be corrected. (7 points) Original cladogram: camel hippo pig whale Organism DNA Sequence Camel Whale Hippo Pig 5... AATCGCGATATACGCGTATACGTGTCAGTCTGTACGTAGCCTTAGC ...3 5... AATCGCGATATACGCGTATACGTGTCAGTCTGTACGTAGAGTTAAC ...3 5... AATCGCGATATACGCGTATACGTGTCAGTCTGTACGTAGAGTTACC ...3 5... AATCGCGATATACGCGTATACGTGTCAGTCTGTACGTAGATTTAGC ...3

Explanation / Answer

The DNA sequences for the aligned region not supporting the above cladogram. According to sequence comparisons between each pair of animals as represented in the table, camel and hippo are distantly related, but the cladogram showing them as near. Pig is showing the same similarity with all other species so three other species need to be at an equal distance with the pig.

If the pig make the root of cladogram in which it is in an equal distance with others, and camel is placed far from whale and hippo, so that hippo and whale will be nearer to each other, then the cladogram is considered as correct for the given data set

camel whale hippo pig camel 46 42 42 44 whale 46 45 44 hippo 46 44 pig 46