Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Please answer part b and question 5. Please answer questions within the image. I

ID: 317325 • Letter: P

Question

Please answer part b and question 5. Please answer questions within the image. I am confused on how to draw out the answers to the questions on the images.

b) Directionality: RNA polymerase initiates transcription of the double stranded DNA given below at the indicated transcription start site. Write the sequence of the resulting RNA in the 5' to 3' direction into the box given below. (5 points) 5-ATGC TGACGTCCGTTAGGGCAATTCCATACGTAACCGTAGTCAAGTCAATT TACGTACGGTA-3 5.) DNAsel Footprinting You perform 4 DNAsel footprinting experiments. All the experiments contain DNA 1. Experiments 2,3, and 4 also contain Protein A which binds DNA 1 in the indicated position. DNA 1 is labeled by radio labels on the indicated ends. Arrows show positions that DNAsel can cut. Draw the banding pattern you expect to see in the 4 different experiments in the box on the right. (16 points) Experiment 1 2 3 4 40 80 20 60 80 Experiment 1 DNA 1 60 Experiment 2 DNA 1 40 Experiment 3: DNA 1 20 Experiment 4 DNA 1

Explanation / Answer

RNA polymerase moves from transcription initiation site from 3' to 5' direction forming an antiparallel RNA strand that grows from 5 to 3 direction. The antiparallel RNA strand is formed from template DNA base pair sequence matching Uracil with Adenine in place of Thymine unlike DNA pairing. So the complementary strand would be as follow:

5'-GUAUGGAAUUGCCCUAACGGACGUCAGCAU-3'

Note: starting from transcription start site at C towards left till A in the 5' complement G wit C, U with A, A with T, and C with G....

In DNAse footprinting experiment the DNA bound to protein is not chewed (enzymatic cleavage is prevented). In absence of DNA binding protein the entire DNA fragment is almost uniformly fragmented as referred as "free DNA". Due to restricted fragmentation in protein binding zone there will be gap in random smearing of corresponding molecular weight DNA that will form between protein binding position and radiolabel in the DNA.

You can save the image.

Open the image in image editing program like paint and Photoshop.

Type by inserting text box and painting in desired place.

Experiment 1 column will have no gap in random banding.

Exp 2 will have a gap in 60 (60-0)

Exp 3 will have a gap in 20 (80-60)

Exp 4 will have a gaps in 60 (60-0) and 20 (80-60) label in both end

OK let me try to do that for you within my limited time or will answer in next time.