Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

I think I may be overthinking this one, can someone please help with a. ? The E.

ID: 319042 • Letter: I

Question

I think I may be overthinking this one, can someone please help with a. ?

The E. coli genome contains the following coding strand sequence. (Note that the DNA coding strand has the same base sequence as the mRNA, except that the DNA contains Ts, instead of Us.) The transcription start site has been bold-italicized:

5'–GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTTATTCCCACAAA–3'

a.   Name the transcriptional regulatory element present upstream of the transcription start site, and describe its function.

b.   Underline the translation initiation codon.

c.   What is the sequence of amino acids (using the three-letter abbreviations) translated from this transcript?

Explanation / Answer

a). The Pribnow box is located at -10 upstream of the transcription start site (TATAAT). The Pribnow box is identified by the RNA polymerase to initiate the transcription from Transcription start site.

b). Translation initiation codon

GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTTATTCCCACAAA–3'

c). Protein sequence would be

Met-Leu-Leu-Pro-Trp-Leu-Phe-Pro-Gln