Question
The following DNA sequence shows a "gene" encoding a smallpolypeptide. The start codon is AUG and the three "stop" codons areUAA, UAG, and UGA. The promoter region of the DNA is inparetntheses.
5' (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5'
using the mRNA codon chart, transcribe and translate the"gene" from above.
a) which DNA strand did you choose as the template strand? Topor bottom? Why?
b) mRNA sequence (not including promoter region)=
c) mRNA sequence from start to stop codon=
d) anticodons for each codon=
e) amino acid sequence (including start amino)=
5' (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5'
using the mRNA codon chart, transcribe and translate the"gene" from above.
a) which DNA strand did you choose as the template strand? Topor bottom? Why?
b) mRNA sequence (not including promoter region)=
c) mRNA sequence from start to stop codon=
d) anticodons for each codon=
e) amino acid sequence (including start amino)=
Explanation / Answer
5' (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3' 3' (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5' DNA: 3' (TACTG CATATT) ACTGGC ATGTACTC ATTA TGTATTT AG TC 5' mRNA: 5' (AUGACGUAUAA)UGACCGUACAUGAGUAAUACAUAAAUCAG 3' mRNA: 5' (AUG ACG UAU AA)U GAC CGU ACAUGA GUA AUA CAU AAA UCAG 3' Protein- Met- Thr- Tyr- Asn- Asp- Arg- Thr- STOP a)Transcription has to occur in the 5'-3' direction. For this the DNA strand needs to be in the 3'-5'direction.Hence we choose the second strand of DNA. b)mRNA sequence (not including promoter region): 5' UGACCGUACAUGAGUAAUACAUAAAUCAG 3' c) mRNA sequence from start to stop codon: AUG ACG UAU AAU GAC CGU ACA UGA Protein- Met- Thr- Tyr- Asn- Asp- Arg- Thr- STOP a)Transcription has to occur in the 5'-3' direction. For this the DNA strand needs to be in the 3'-5'direction.Hence we choose the second strand of DNA. b)mRNA sequence (not including promoter region): 5' UGACCGUACAUGAGUAAUACAUAAAUCAG 3' c) mRNA sequence from start to stop codon: AUG ACG UAU AAU GAC CGU ACA UGA d) anticodons: Codon: AUG ACG UAU AAU GAC CGUACA UGA Anticodon: UAC UGC AUA UUA CUG GCA UGU ACU Codon: AUG ACG UAU AAU GAC CGUACA UGA Anticodon: UAC UGC AUA UUA CUG GCA UGU ACU e) amino acid sequence: Met-Thr-Tyr-Asn-Asp-Arg-Thr-STOP