Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Use the following information to answer the next four questions. The following D

ID: 70543 • Letter: U

Question

Use the following information to answer the next four questions. The following DMA sequence codes for a small protein. Assuming that transcription begins on the left of this sequence and that translation begins with a methionine, use the codon table provided In class (or anywhere else), to determine how many ammo acids are encoded by this sequence. The sequence below shows the same sequence except for a mutation (shown with a lowercase letter). This mutation is a The sequence shown in question 1 has a mutation shown below (in lower case). Which of the mutations above would you expect to have a more severe mutant phenotype?

Explanation / Answer

Question 1) Answer is d, 11

3’ATGGAGGGCGTGCGTATAGATCCTAAATAGCTTA5’ DNA template

5’AUGGAGGGCGUGCGUAUAGAUCCUAAAUAGCUUA3’ mRNA

The above mRNA codes for 11 amino acids

Question 2) Answer is b, Frame shift mutation.

Here the insertion of an extra base pair in the DNA will change the reading frame, thus causes frame shift mutation. The RNA produced from this frameshift mutation will not have the same reading frame.

Question 3) Answer is b, Frame shift mutation. Here the insertion of CG in the place AT is changing the reading frame.

Question 4) Answer is a, the addition of one extra base pair will change whole reading frame, thus causing the loss of activity.