Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Sequence 1 given below is to be sequenced by the primer 5 \'TAGT AGCCGGT ACGACTG

ID: 71187 • Letter: S

Question

Sequence 1 given below is to be sequenced by the primer 5 'TAGT AGCCGGT ACGACTGAA3 ' >Sequence 1 (5' -3') GTCGAGCGGGCAAACCGGCACGCCGGGCGTCCGCGGCGCGCATAGGGAGTCTCCAGTCCTGTGTTCCATCCTCTGGCTGCGGGCTTCGGCCGCCTCTACTAGCGCGACGCGAGTCGTCCCGGCGGATAGGGCCGTGCGGTCTTGTCGTCGGCGTGTCCCGCGAAACGGGTGTGGGAGGACCGTCGCTTCAGGCGGACGGGGCGCCTCTCCGTACCCCGCCAAAATTCAGTCGTACCGGCTATAGCACCGCCCAGTAGGGCTGGGGCCGGGCGTCAGGTCTGTTAGTAGGACGCGAGC Find the place of attachment of the given primer. Is it a forward reverse primer? Will the resulting sequence match Sequence 1 or will it be complementary to it? Give the first 15 bases the sequencing machine will read. Design a primer that will sequence in a direction opposite to the one given. The primer should have the following specifications: It is 21 base pairs long, you want to sequence more than 150 base pairs, and it should contain 50 to 55 % G+C. Why aren't products of sequencing reactions run on agarose gels?

Explanation / Answer

Sequence 1 given below is to be sequenced by the primer 5 'TAGT AGCCGGT ACGACTG