Refer to the figure below, which depicts a typical prokaryotic gene, for the fol
ID: 174077 • Letter: R
Question
Refer to the figure below, which depicts a typical prokaryotic gene, for the following four questions. The sequences labeled as "regions A-D" include both strands over the area highlighted. Region A Region B Region C Region D 5 ' ...GCCATTAGTTAGCCCA ATATATGATAGAAGCACTCTACTGTCAACTCAAT AOGTCCACGC ... 3' ...CGGTAATCAATCGGGTTATATACTATCTTCGTGAGATGACAGTTGACTTATCCAGGTGCG ... Which of the following statements is NOT a correct description of RNA as compared to DNA? RNA molecules have a hydroxyl group at the 2' position of the sugars that DNA molecules lack. Because they usually are single-stranded, RNA molecules are simpler in their three-dimensional structure titan DNA molecules. RNA molecules are less stable and turnover more rapidly than DNA molecules. RNA molecules have U in place of T found in DNA molecules Some RNA molecules can catalyze biological reactions, but DNA cannot.Explanation / Answer
Which of the following statements is NOT a correct description of RNA as compared to DNA?
A.
RNA molecules have a hydroxyl group at the 2' position of the sugars that DNA molecules lack.
B.
Because they usually are single-stranded, RNA molecules do not have three-dimensional structure, but DNA molecules, which are double-stranded, do.------------ANSWER
C.
RNA molecules are less stable and turnover more rapidly than DNA molecules.
D.
RNA molecules have U in place of T found in DNA molecules.
E.
Some RNA molecules can catalyze biological reactions, but DNA cannot.
=======================================
Ribonucleic corrosive (RNA) is a polymeric atom fundamental in different natural parts in coding, disentangling, direction, and articulation of qualities. RNA and DNA are nucleic acids, and, alongside proteins and sugars, constitute the four noteworthy macromolecules basic for every known type of life. Like DNA, RNA is collected as a chain of nucleotides, however not at all like DNA it is all the more regularly found in nature as a solitary strand collapsed onto itself, instead of a matched twofold strand. Cell life forms utilize detachment RNA (mRNA) to pass on hereditary data (utilizing the letters G, U, An, and C to indicate the nitrogenous bases guanine, uracil, adenine, and cytosine) that coordinates amalgamation of particular proteins. Numerous infections encode their hereditary data utilizing a RNA genome.
Some RNA atoms assume a dynamic part inside cells by catalyzing natural responses, controlling quality expression, or detecting and conveying reactions to cell signals. One of these dynamic procedures is protein union, an all inclusive capacity where RNA particles coordinate the get together of proteins on ribosomes. This procedure utilizes exchange RNA (tRNA) particles to convey amino acids to the ribosome, where ribosomal RNA (rRNA) then connections amino acids together to shape proteins.
DNA, or deoxyribonucleic corrosive, is the inherited material in people and every single other creature. Almost every cell in a man's body has a similar DNA. Most DNA is situated in the phone core (where it is called atomic DNA), yet a little measure of DNA can likewise be found in the mitochondria (where it is called mitochondrial DNA or mtDNA).
The data in DNA is put away as a code made up of four substance bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA comprises of around 3 billion bases, and more than 99 percent of those bases are the same in all individuals. The request, or succession, of these bases decides the data accessible for building and keeping up a living being, like the path in which letters of the letter set show up in a specific request to shape words and sentences.
DNA bases match up with each other, A with T and C with G, to shape units called base sets. Every base is additionally appended to a sugar atom and a phosphate particle. Together, a base, sugar, and phosphate are known as a nucleotide. Nucleotides are masterminded in two long strands that shape a winding called a twofold helix. The structure of the twofold helix is to some degree like a stepping stool, with the base sets shaping the stepping stool's rungs and the sugar and phosphate atoms framing the vertical sidepieces of the step.
An essential property of DNA is that it can imitate, or make duplicates of itself. Every strand of DNA in the twofold helix can serve as an example for copying the succession of bases. This is basic when cells partition in light of the fact that each new cell needs a precise of the DNA exhibit in the old cell.
A.
RNA molecules have a hydroxyl group at the 2' position of the sugars that DNA molecules lack.
B.
Because they usually are single-stranded, RNA molecules do not have three-dimensional structure, but DNA molecules, which are double-stranded, do.------------ANSWER
C.
RNA molecules are less stable and turnover more rapidly than DNA molecules.
D.
RNA molecules have U in place of T found in DNA molecules.
E.
Some RNA molecules can catalyze biological reactions, but DNA cannot.
=======================================
Ribonucleic corrosive (RNA) is a polymeric atom fundamental in different natural parts in coding, disentangling, direction, and articulation of qualities. RNA and DNA are nucleic acids, and, alongside proteins and sugars, constitute the four noteworthy macromolecules basic for every known type of life. Like DNA, RNA is collected as a chain of nucleotides, however not at all like DNA it is all the more regularly found in nature as a solitary strand collapsed onto itself, instead of a matched twofold strand. Cell life forms utilize detachment RNA (mRNA) to pass on hereditary data (utilizing the letters G, U, An, and C to indicate the nitrogenous bases guanine, uracil, adenine, and cytosine) that coordinates amalgamation of particular proteins. Numerous infections encode their hereditary data utilizing a RNA genome.
Some RNA atoms assume a dynamic part inside cells by catalyzing natural responses, controlling quality expression, or detecting and conveying reactions to cell signals. One of these dynamic procedures is protein union, an all inclusive capacity where RNA particles coordinate the get together of proteins on ribosomes. This procedure utilizes exchange RNA (tRNA) particles to convey amino acids to the ribosome, where ribosomal RNA (rRNA) then connections amino acids together to shape proteins.
DNA, or deoxyribonucleic corrosive, is the inherited material in people and every single other creature. Almost every cell in a man's body has a similar DNA. Most DNA is situated in the phone core (where it is called atomic DNA), yet a little measure of DNA can likewise be found in the mitochondria (where it is called mitochondrial DNA or mtDNA).
The data in DNA is put away as a code made up of four substance bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA comprises of around 3 billion bases, and more than 99 percent of those bases are the same in all individuals. The request, or succession, of these bases decides the data accessible for building and keeping up a living being, like the path in which letters of the letter set show up in a specific request to shape words and sentences.
DNA bases match up with each other, A with T and C with G, to shape units called base sets. Every base is additionally appended to a sugar atom and a phosphate particle. Together, a base, sugar, and phosphate are known as a nucleotide. Nucleotides are masterminded in two long strands that shape a winding called a twofold helix. The structure of the twofold helix is to some degree like a stepping stool, with the base sets shaping the stepping stool's rungs and the sugar and phosphate atoms framing the vertical sidepieces of the step.
An essential property of DNA is that it can imitate, or make duplicates of itself. Every strand of DNA in the twofold helix can serve as an example for copying the succession of bases. This is basic when cells partition in light of the fact that each new cell needs a precise of the DNA exhibit in the old cell.