Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Refer to the figure below, which depicts a typical prokaryotic gene, for the fol

ID: 174078 • Letter: R

Question

Refer to the figure below, which depicts a typical prokaryotic gene, for the following four questions. The sequences labeled as "regions A-D" include both strands over the area highlighted. Region A Region B Region C Region D 5 ' ...GCCATTAGTTAGCCCA ATATATGATAGAAGCACTCTACTGTCAACTCAAT AOGTCCACGC ... 3' ...CGGTAATCAATCGGGTTATATACTATCTTCGTGAGATGACAGTTGACTTATCCAGGTGCG ... If you were analyzing the DNA sequence of a novel bacterium with the help of a computer to search for open reading frames, you would be looking for potential protein-coding regions of DNA. Be looking for rRNA sequences encoded by the DNA. Wisely follow up on every ORF that is at least 30 nucleotides long. Search only one reading frames because only one will be relevant for coding protein. Search only top DNA strand because only one strand will be coding.

Explanation / Answer

On analyzing the open reading frame of a DNA sequence of a novel bacterium, one would be looking for potential protein-coding regions of DNA as these regions are translated into amino acid sequence.