Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Can someone check my answers and see if theyre correct? If it isn\'t can you exp

ID: 204624 • Letter: C

Question

Can someone check my answers and see if theyre correct? If it isn't can you explain why please? If it's too much then you don't need to explain it then, Thank you!

The stand of dsDNA that is read by RNA polymerase is termed the NA polymerase moving direction strand with R -_ along it. The polymerase forms a-- growing in the a. template; 5' 3'; transcript; 3'5' b. template, 3' 5'; transcript; 5'3' c. transcript; 3' 5'; template: 5'3' d. nontemplate: 5' 3'; template, 3'5' e. nontemplate: 3'5 '; template, 5-3 The following DNA sequence comes from the middle of an open reading frame (ORF). The arrow shows the direction of transcription. The gene has no intron sequences ORF 5 ATGACCCTGATATCTATAGTTACAGTCTAGAG 3' 3' TACTGGGACTATAGATATCAATGTCAGATCTC 5 The first four full codons in this DNA sequence encode which of the following amino acid sequences? (Hint: scan for a reading frame that does not contain a stop codon.) A. Methionine, Threonine , Leucine, Isoleucine B. Leucine, Aspartic Acid, Cysteine, Asparagine C. Serine, Arginine, Leucine, Stop D. Methionine, Serine, Aspartic Acid, Leucine E. Tyrosine, Glycine, Glutamic Acid, Tyrosine

Explanation / Answer

All are mostly correct , but 4th and 13th.

In 4, the anticodon on tRNA is GGT, it will bind to CCU on mrna , which codes for proline.

13. b: binding of multiple Xist to Xic on the chromosome that will be inactivated.