Can you please help me answer the green highlighted questions? Is my RNA copy co

Question

Can you please help me answer the green highlighted questions? Is my RNA copy correct or is that suppose to be tRNA? Also, I'm not sure how to use the mRNA codon graph on the left to answer the Peptide Sequence. Please help! Thank you!

this graph is mRNA (codon) to Amino Acid Using the Chart transcribe and translate the following: Remember to START at the START CODON during tran Template: TATAACCTTACACGGCTGCACGTTTGACGGGCCCCCTTGATGGATTCGT Valine A RNA Copy (highlight the codons): Leucine tRNA: AcUGACU Peptide Sequence: Describe/Explain how a peptide sequence creates a physical characteristic. Identify the types of mutations Explain. ONA levelTTC mRNA level AAG protein levelLys ??? ATC UAG STOP Arg AGG Lys

Explanation / Answer

Can you please help me answer the green highlighted questions? Is my RNA copy co

Related Questions

Navigate

• Browse (All)
• Browse C
• Subjects

---