A DNA sequence is a sequence of some combination of the characters A (adenine),
ID: 3938825 • Letter: A
Question
A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DNA. Given a long DNA sequence, its often necessary to compute the number of instances of a certain subsequence. For this exercise, you will develop a program that processes a DNA sequence from a file and, given a subsequence s, searches the DNA sequence and counts the number of times s appears. As an example, consider the following sequence: GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC If we were to search for the subsequence GTA, it appears twice. You will write a program (place your source in a file named dnaSearch.c) that takes, as command line inputs, an input file name and a valid DNA (sub)sequence. That is it should be callable from the command line as: ./dnaSearch dna01.txt GTA Handin dnaSearch.c. No additional files should be handed in.Explanation / Answer
// C program dnaSearch.c
#include <stdio.h>
#include <stdlib.h>
#include <time.h>
#include <ctype.h>
#include <string.h>
int main(int argc, char const *argv[])
{
FILE *inputFile;
if(argc < 3)
{
printf("Input arguments missing ");
return 0;
}
if ((inputFile = fopen(argv[1], "r")) == NULL)
{
printf("Error! opening file");
// Program exits if file pointer returns NULL.
exit(1);
}
int i,j ;
char str[100], sub[100];
// open file
inputFile = fopen(argv[1],"r");
// reads text until newline
fscanf(inputFile,"%[^ ]", str);
strcpy(sub , argv[2]);
int count = 0;
const char *tmp = str;
while(tmp = strstr(tmp, sub))
{
count++;
tmp++;
}
printf("%s appears %d times ", sub, count);
fclose(inputFile);
return 0;
}
/*
dna01.txt
GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC
output:
GTA appaers 2 times
*/