Please help! Having a difficult time with this question... G alpha z ( Gz ) is a
ID: 64975 • Letter: P
Question
Please help! Having a difficult time with this question...
G alpha z (Gz) is a protein 355 amino acids in length. It is synthesized in the cytoplasm, and lacks a signal sequence or a nuclear import sequence or patch. See this link for the amino acid sequence of human Gz: http://www.ncbi.nlm.nih.gov/protein/AAH78163.1 After its initial synthesis, Gz is bound by another protein called a palmitoyltransferase, which covalently attaches a fatty acid called palmitate to a cysteine side chain near the N-terminus of Gz. This lipid modification allows Gz to associate with the inner face of the plasma membrane. Now, suppose you discover a mutant form of Gz, and when you perform a fractionation of cells expressing this protein, you detect it in the cytoplasmic fraction. (In a control sample, you detect normal Gz in the plasma membrane fraction, as expected.) You decide to try cloning (isolating) the cDNA that encodes this mutant form of Gz, and in your lab work you obtain three different clonal human cDNAs with the following sequences:
clone A. 5’- cgctgctgccagaccatgggatgtcggcaagcctcagag [hundreds more bases] -3’
clone B. 5’- cgctgctgccagaccatgggaggtcggcaaagctcagag [hundreds more bases] -3’
clone C. 5’- cgctgctgccagaccatgggatgtcggcaaagctcagag [hundreds more bases] -3’
Note that these cDNAs include a small region upstream of the start codon sequence. Of these three cDNA clones, indicate which one encodes the Gz mutant of interest, and explain your reasoning precisely.
*This is the amino acid sequence given below is the same one found in the link listed in the question.
ORIGIN
1 mgcrqsseek eaarrsrrid rhlrsesqrq rreikllllg tsnsgkstiv kqmkiihsgg
61 fnleackeyk pliiynaids ltriiralaa lridfhnpdr aydavqlfal tgpaeskgei
121 tpellgvmrr lwadpgaqac fsrsseyhle dnaayylndl eriaaadyip tvedilrsrd
181 mttgivenkf tfkeltfkmv dvggqrserk kwihcfegvt aiifcvelsg ydlklyednq
241 tsrmaeslrl fdsicnnnwf intslilfln kkdllaekir riplticfpe ykgqntyeea
301 avyiqrqfed lnrnketkei yshftcatdt sniqfvfdav tdviiqnnlk yiglc
Explanation / Answer
Clone A: 5’- cgctgctgccagaccatgggatgtcggcaagcctcagag- 3’--- RCCQTMGCRQASE...
Clone B: 5’- cgctgctgccagaccatgggaggtcggcaaagctcagag-3’--- RCCQTMGGRQSSE...
Clone C: 5’- cgctgctgccagaccatgggatgtcggcaaagctcagag-3’--- RCCQTMGCRQSSE...
Observing the given sequences, it is identified that there is only one amino acid change amongst the three clone sequences. From this data, it is not easy to identify which clone is encoding the Gz mutant of interest, since the obtained amino acid seqences are not matching with the sequence obtained from the given link.