Please explain question 7/8 step by step use A. which of the following methods s
ID: 81000 • Letter: P
Question
Please explain question 7/8 step by step use A. which of the following methods shou it to to prep Anion exchange chromatography B. Gel filtration followed by C. Gel filtration followed by cation exchange chromatography D. Nickel affinity E. Differential centrifugation followed by immunoprecipitation Given the following DNA coding strand of Gene X (remember DNA is double stranded): 5' ATCGTAGCTGATCGATGATCGATGT GACCTGA-3' 7. Which of the following could be used as an RNA primer to replicate the coding strand? A. 3' UAGCAU-5' B. 5' -UCAGGU 3' C. 5' UAGCAU 3' D. 3' -UCAGGU 5' 8. Which of the following represents the RNA molecule that would be transcribed from this gene? A. 5' UCAGGUCACAUCGAUCAUCGAUCAGCUACGAU-3' B. 3' UCAGGUCACAUCGAUCAUCGAUCAGCUACGAU-5' C. 3' A UCGUAGCUTGAUCGAUGAUCGAUGUGACCUGA 5' D. 5' AUCGUAGCUGAUCGAUGAUCGAUGUGACCUGA-3
Explanation / Answer
Ans. 7. RNA polymerase binds to template DNA (at 3’ end of template DNA) and carries out transcription in 5’-3’ direction.
DNA replication also occurs in 5’-3’ direction. DNA pol binds to 3’-ends of coding DNA and synthesizes the new strand in 5’-3’ direction.
Step 1: Create the templet strand complementary of coding strand –
5’-ATCGTAGCTGATCGATGATCGATGTGACCTGA-3’ Coding strand
3’-TAGCATCGACTAGCTACTAGCTACACTGGACT- 5’ Template strand
Step 2: The RNA primer is complementary of coding DNA. So, for DNA pol to bind at 3’end of coding strand, the sequence of RNA primer is the same as template DNA in 5’-3- direction except T in template DNA is replaced by U in RNA primer.
Now, template DNA strand = 5’-TCAGGT-3’ - only first six nucleotides as in primer
RNA primer = 5’-UCAGGU-3’ ; [T in Template DNA replaced by U in RNA primer]
Thus, correct option = B.
#8. The sequence and polarity of coding strand is exactly the same as that of mRNA except the T in coding strand is replaced by U in mRNA being synthesized.
Step 1. Write coding strand sequence-
5’-ATCGTAGCTGATCGATGATCGATGTGACCTGA-3’
Step 2: Change all T with U without changing the polarity. It’s the mRNA-
5’- AUCGUAGCUGAUCGAUGAUCGAUGUGACCUGA-3’
So, correct option = D