Report all segments of identity by descent longer than 20 polymorphisms between
ID: 3890576 • Letter: R
Question
Report all segments of identity by descent longer than 20 polymorphisms between pairs of individuals in the following cohort of 15 individuals across 49 polymorphisms:
1 gtctctcggtaggcctcttggcagctctatcggcgagtatctcggcacg
2 gtctcgtgacaggtatctcggtaactatctcggtagctaacgcggcgtg
3 gtcactcggtaggcctctcggtgagtatctcgataggtaactcggcgtc
4 atctcgcggtagccaacttggtaggtctatcggcaagtctctccgcgcc
5 gtctctcggcaggtatattcataggtctattgataggtcacttggcatg
6 gtcacgccgtaggtaacttcgtaggtctatcggtaggtctcgtgacatg
7 gcctatcggtgaccaactcgatgggtctatcggcaagccacgcgatgtg
8 gtctcttcgtagctatcttcataggtcacgcgatgggtcacgcggtgtc
9 gtatctcggtaggcatctcggtagctctatccgtaagtatctcgatgtc
10 atatcttggcaaccaactcgatgggtctatcggcaagccacgcgatatg
11 gtctctcggtaagtatctccgcgagtcaatcgacgggtctatcgacatc
12 atctctcggtaggcctctcggtgagtatctcgataggtctatcggtatg
13 gtcacgcgatagctctctcggtgactctcttggcaggtctatccacgtc
14 gcctctcggtaggcctctcggcaggtcaattggtgggtctctcgatatc
15 gtctcgcgataggtatctcgatgggtctcttgatgggtctctccgcatg
For example if the sequence is "bcd", which occurs in "abcdef" , the starting point would be 2 (b), and the finishing point would be 4(d).
Individuals 7,10 between positions________________________and______________________________
For example if the sequence is "bcd", which occurs in "abcdef" , the starting point would be 2 (b), and the finishing point would be 4(d).
Individuals 3,12 between positions______________________and_________________________________
Explanation / Answer
For the Individuals 7,10. They are between:
1) 7(c) and 10(t)
2) 7(t) and 10(c)
3) 7(c) and 10(t)
4) 7(c) and 10(t)
5) 7(c) and 10(c)
6) 7(c) and 10(t)
7) 7(c) and 10(t)
8) 7(t) and 10(t)
9) 7(c) and 10(t)
10) 7(t) and 10(c)
11) 7(c) and 10(t)
12) 7(c) and 10(t)
13) 7(c) and 10(t)
14) 7(c) and 10(t)
15) 7(c) and 10(t)
For Individuals 3,12between
1) 3(c) and 12(g)
2) 3(c) and 12(g)
3) 3(c) and 12(g)
4) 3(c) and 12(g)
5) 3(c) and 12(g)
6) 3(c) and 12(g)
7) 3(c) and 12(a)
8) 3(c) and 12(g)
9) 3(a) and 12(g)
10) 3(a) and 12(a)
11) 3(c) and 12(a)
12) 3(c) and 12(g)
13) 3(c) and 12(g)
14) 3(c) and 12(g)
15) 3(c) and 12(g)
Thank you. If any queries, ask in comment section.